Lab 1- Systematic Resources on the web - taxonomy

Biol 615 Systematics & Comparative Biology, (Sikes) Fall 2012

PLEASE DO NOT PRINT THIS PAGE - use a piece of your notebook paper to write the answers.

Answer the questions below. Tip: keep various webpages open simultaneously to more quickly move among them.

Introduction: This exercise will aquaint you with various web resources, particularly those produced by (and sometimes for) systematists. Completing this exercise is much like a scavenger hunt for information - note that some questions ask you to speculate / think of possible explanations. Although there are many informative resources on the web, these links are intended to qualify as a sort of 'primary' source of information in the sense that they include authoritiative information, rather than summaries of such (as seen in secondary sources). Please do not rush through this exercise, take a few moments to appreciate and familiarize yourself with each resource.

Note: Keep in mind the category of the resource being used. Most are not strong in all aspects but usually emphasize one of these three: (1) taxonomic names, (2) specimen / distributional data, (3) identification.

 

1. Search the Encyclopedia of Life for the taxon Nicrophorus nigrita.

A. How many different classifications does this taxon appear in? List the names of each classification and describe 3 things that are different among the 3 classifications. Do any classifications contradict each other? (I will explain what this means in lab).

B. Often distributional information is lacking entirely or is unreliably sparse - this taxon has 3 maps, view each map in detail (see 'view source' to the right of each map. Compare these 3 maps - are they redundant? do any have suspiscious records? Can you "drill down" to find the specimen data and museum repository for records on all maps? Pick an outlier record, like that New Mexico record, and try to find out who identified the specimens to see if they were authoritatively identified.

C. Click the 'Literature' tab on the EOL page. Notice it has two sub-sections: Literature References and Biodiversity Heritage Library. Compare the first section to a simple Google Scholar search on the taxon name (use quotes around the name). How many Google Scholar hits are there? Now explore the BHL link. The BHL is an incredible resource for taxonomic and biodiversity researchers who need access to older literature unavailable in their nearest libraries.

D. Now search EOL on a taxon of your choice. Provide the name of the taxon and summarize the aspects addressed above for it.

 

2. Visit the on-line version of the International Code of Zoological Nomenclature (ICZN) and read the article describing what constitutes a published work (Criteria of publication):

 According "the criteria to be met" can, in your judgement, a webpage count as a published work under the ICZN? Why or why not?

Just this week an ICZN amendment was published of great relevance - what does this allow?

3. Visit the Tree of Life and beginning at the ROOT, click through the tree to locate the most terminal (closest to the species group) pages for a taxon of your research / interest.

 A. The taxon you sought:____________________

 B. Did it have an information page? Y  /  N

 C. If not, how close did you get, i.e. what was the closest page with information?

 

 4. Visit the Society of Systematic Biologists Homepage (http://www.systbio.org/ )

A. How much is a student membership this year?

B. What awards are available for students? Provide their names, award amounts, and for what the award is for (i.e. how to qualify).

5. Visit the The Systematics Association website: (http://www.systass.org/).

Go to the Awards link. What are the maximum awards available for the SRF competition, and how many applicants received awards?

6. Visit the Natural History Museum guide to twig lichens (http://internt.nhm.ac.uk/jdsml/nature-online/lichen-id-guide/) and identify the following lichen: branched, with fruits present and grooved branches.

A. Species name (with author):

B. Does this lichen species prefer unpolluted areas?

7. Visit the Tiger Beetles of Connecticut website (if it's online, often the server crashes... a good lesson to learn about small-scale, in-house, web products) (http://collections2.eeb.uconn.edu/collections/insects/CTBnew/ctb.htm)  and identify the following CT tiger beetle: dorsal surface metallic green and lacking rows of small green dots but with small white marks, abdomen brown.  It was found in a forest on a sandy trail.

A. Species name (with author):

B. Is it of conservation concern?

8. Visit Lucid Central (http://www.lucidcentral.org/en-us/keys173;/searchforakey.aspx) and scroll down to the moth key link & select it. Lucid is an Australian Java-based multi-access ID system. They are developing new mobile-device apps.

A. Can you load the ID key on your computer? (On my Mac it fails due to an inactive plug-in).

B. Does Lucid have a key to any taxon you might want to identify for your research?

9. You have just completed sequencing a new zoological tissue sample and obtained back the following portion of the Cytochrome Oxidase I sequence:

aaaattcaatatatgcataataactaataagtacacagtagagttactgttatctgtgtc

which, surprisingly, does not align (match) with any of your other COI sequences. To help solve this problem you can do a BLAST search on the NCBI website. Click the BLAST link and then under the nucleotide options click on the nucleotide-nucleotide link (make sure the Choose Search Set is selected on 'nucleotide collection nr/nt'). Copy the above sequence and paste it into the search field. Then click the Blast! button to search for any matches to this sequence. When the search is complete you will get a list of possible matches with the best matches near the top.

A. What is the best match for this sequence? Provide the species name & the higher classification for this species.

B. What do you think might have happened? i.e. where did this odd sequence come from?

10. DNA Barcoding is proposed as a solution to the taxonomic bottleneck of there not being enough taxonomists to identify the world's organisms. Go to the Barcode of Life Web portal: http://www.barcodinglife.com/ and click the link for IDENTIFICATION on the upper banner. You will be test the Barcode Identification Engine by querying it with a sequence not already in the database.

A. The sequence below belongs to a beetle in the family Salpingidae. Copy and paste the sequence below into the form field that says "Enter sequences in fasta format:" and then select "All Barcode Records on BOLD " and click submit.

AGATATTGGGACCCTATATTTTATTTTTGGAGCGTGATCGGGAATAGTGGGAACTTCTTTA
AGACTATTAATTCGTGCAGAATTAGGAAACCCCGGCTCTTTAATTGGAGACGATCAAATT
TATAATGTAATTGTAACAGCCCATGCTTTTGTAATAATTTTTTTTATAGTTATGCCAATTAT
AATTGGCGGGTTCGGAAATTGGTTAGTCCCATTAATACTGGGAGCCCCTGATATAGCCTTT
CCTCGAATAAATAATATAAGATTCTGATTATTACCCCCCTCTCTCACTCTTCTAATTATAAG
AAGAGTTGTTGAAAATGGGGCAGGAACTGGTTGAACAGTTTATCCTCCTTTAGCATCTAAT
ATCGCCCATAGAGGTTCTTCAGTAGATTTAGCTATTTTTAGTCTTCATCTAGCAGGAATTTC
GTCAATTCTGGGTGCTGTAAATTTCATTACTACAGTTATTAATATACGCCCATCTGGAATAA
CCTTAGATCGAATACCTTTATTTGTGTGATCTGTAGTAATTACAGCAGTTTTACTTTTACTCT
CTCTTCCAGTATTAGCGGGCGCAATTACTATACTATTAACTGACCGTAACTTAAATACTTCC
TTTTTTGATCCAGCGGGGGGTGGGGACCCTATTTTATACCAACATTTATTTTGATTTT

B. What do you think of the results? Why are none of the possible matches in the family Salpingidae? Try the Tree-based identification link. All but one of the tips of the tree are beetles - can you spot the non-beetle? Why would this non-beetle sequence be mixed in with the beetles?

C. Now try to identify this sequence using BLAST (remember to make sure you are querying the nucleotide database). Does BLAST do a better or worse job at helping identify this 'unknown' organism?

D. Click into the topmost BLAST record (should be Drosophila quadrisetata) and click to view it in FASTA format. Copy and paste the sequence into the BOLD Identification page and submit. What are the top two matches and what are their 'specimen similarity (%)' scores? This should be an example of BOLD working well. What do you think of this approach to identification - pros & cons? What does it need to work properly? Traditional, morphology-based identification usually cannot provide a similarity (%) score. Comment on the use of this confidence measure (note how many hits are above 90% similar).

11. Visit Arctos (http://arctos.database.museum/). Arctos is the online database that UAM and other institutions such as UC Berkeley's Museum of Vertebrate Zoology are using. It is one of the most secure and stable online data sources for museum specimen data.

A. Search Arctos for a taxon of your interest (either select a collection to search or use the 'search all collections' link at the top). Ask me if you need help - the search form is feature-rich and therefore a little complex. What name did you search on? How many records are found from your query? Are the results mappable? If so does the map seem like a thorough representation of the species' range in the area of interest?

B. One of the "cooler" features of Arctos is the ability to search using a google map bounding box. To do this return to the search form and in the 'Locality' portion click 'Select on Google Map' then you can zoom into a region of the map and using the small red box select an area, or island, etc. and search on a taxon name or other criterion.

12. Visit the Global Biodiversity Information Facility (GBIF) http://www.gbif.org/ which is a data-aggregator site. GBIF pulls in data from data providers like Arctos once every few months. In theory one can query all the world's data providers with a single search. However, unlike the feature-rich search form of Arctos, there are many fields that cannot be search using GBIF such as any locality smaller than country (eg. state, provice or city).

A. search on the name 'Aclypea opaca' which is a beetle that occurs on the UAF campus in the spring. View the map of occurrence records - does it seem reliable? Why or why not?

13. Visit Harvard's Museum of Comparative Zoology primary type database: http://insects.oeb.harvard.edu/MCZ/index.htm

A. Search the taxonomic catalog for the name Necrophorus. List the different kinds of types specimens that are present:

B. How many of these type specimens' names match their current names? (consider only the specific epithet)

C. You want to verify an identification & think you might have either N. defodiens or N. orbicollis - your specimen has orange antennal clubs. Which of these two species does your specimen agree best with? (use the links to view the images of these specimens).

D. Find the type for Cicindela cyanella & look at the image for the head - dorsal view. The sclerite above the mandibles is called the labrum - how many setae (hairs) are on the labrum of this specimen? Are any broken off? (click on the image to magnify it).

E. Go to the 'About' page from the homepage and read the section "What Are Primary Types and Why Are They Important to Science?" Then explain why, after reading this, it might be faster for a taxonomist to describe the insect fauna of an unstudied island with 100% new species (that were known beforehand to all be undescribed), than it would be to describe the insect fauna of an island where only half of the species are new (and it was unknown beforehand which were new and which weren't)?