Lab 15 - Alignment

Biol 615 Systematics and Comparative Biology, (Sikes)

You will align the sequences below, which are of the transfer RNA Lysine, using both secondary structure and an automated alignment using CLUSTAL. Typically, secondary structure is used to align rRNA sequences - but for this lab you will get a feel for using secondary structure by aligning a much smaller and simpler molecule - a tRNA. This should give you some appreciation for the work involved in doing a much larger molecule like rRNA of over 1000 nucleotides.

This shouldn't take very long but you have a week to complete this. PRINT OUT AND HAND IN A HARD COPY OF YOUR FINAL ALIGNMENTS. Also, an alignment must have no whitespaces in it - use dashes for gaps to ensure that all taxa have either a gap or a nucleotide for every site.

When adding gaps to make your alignment based on secondary structure - remember, gaps are more likley in loops than in stems.

1. First take the Bactrocera sequence and determine its secondary structure

(Scroll down to see the sequences)

To determine the secondary structure:

a. Find the codon(s) for the amino acid Lysine using the genetic code provided in your text or lecture notes; use this codon to find the anti-codon for the tRNA (which will be the reverse compliment of the codon and should be near the middle of the sequence - look at the tRNA structure slide from the lecture notes).

b. Take the Batocera sequence and write the anti-codon on a piece of paper, circle it, then add other nucleotides from the sequence to build the secondary structure of the molecule - I recommend adding one or two on each side of the anti-codon at a time & look for nucleotide strings that might pair across stem regions. This may take some playing around with paper & pencil & some thought to find the 3 stem regions. (recall that A binds to T and G binds to C)

Recall that tRNA has 3 loops and 4 stems in its structure. See these webpages for hints:

classical tRNA structure - use to label your drawings stems & loops (domains)

http://mamit-trna.u-strasbg.fr/ClassicalTrnaStructure.html

(but note that your sequences are totally different - the structure is more or less the same, but the nucleotides are different)

(clue - it might be possible that the acceptor stem lacks pairing...)

2. Second: align them all with each other & label the alignment like this one:

http://mamit-trna.u-strasbg.fr/table/Lysine.html

This page shows a number of aligned tRNA-Lysine sequences from vertebrates with the portions of the sequence that correspond to the secondary structure labeled. You should label yours the same way.

to do an automated multiple alignment use an online version of CLUSTAL-W

http://clustalw.genome.jp/

or

http://www.ebi.ac.uk/Tools/msa/clustalw2/

The sequences you will align (in FASTA format; you can copy them and paste them into the CLUSTAL-W web-interface - be sure to click DNA instead of protein!):

>Nicrophorus
actagatgactgaaagtaagtaatggtctcttaaaccaatttatagtaagttaacgtctac*
>Bombyx mori
cattagatgactgaaagcaagtaatggtctcttaaaccattttatagtaatttagcaactacttctaatga*
>Megalagrion hawaiiense
attaggtgactgaaagtaagtaatggtctcttaaaccacataatagtaaattaacgaaatactcctaatga*
>Bactrocera
attagatgactgaaagcaagtactggtctcttaaaccattttatagtaaattagcacttac*

Compare the quick & fast alignment to the slow & accurate one - is there a difference? What is it?

After CLUSTAL has aligned them you can copy the alignment (from the slow & accurate alignment) and past it into a document - TIP: USE COURIER FONT. Then annotate the alignment to indicate the structure:

Use square brackets [ ] to enclose regions that are in stems and enclose the anticodon in parentheses ( )

3. Finally, align a new sequence, that of the tRNA-Lys of Strongylocentrotus purpuratus (an urchin)

CCTTAATTAGCTTATTTTAAAGCTTTAGACTCTTAATTTAAAAGAAATTAGCTAATACCTATTATTAAGGA

Format it in FASTA format (see above) and then align it with the other sequences using CLUSTAL.

Then take that alignment and annotate it using your knowledge of the secondary structure - did CLUSTAL align it properly? are the stems and anticodon sites homologous? If CLUSTAL did not align them correctly do so manually yourself using your knowledge of secondary structure. Make sure the stem regions are aligned - add as many gaps as needed into the loop regions to keep the stems aligned.


Checklist:

turn in:

1. a diagram with labels of the secondary structure of the Bactrocera tRNA sequence

2. an alignment of all the sequences with annotations to indicate secondary structural regions (anti-codon & stems) & comment on difference if any between fast & slow alignment with CLUSTAL

3. an alignment as in #2 but with the Strongylocentrotus sequence added & comments on the alignment