Lab 1- Systematic Resources on the web

Zool 575 Introduction to Biosystematics, (Sikes) Winter 2006

PLEASE DO NOT PRINT THIS PAGE - use a piece of your notebook paper to write the answers.

Load this page and then in a new window load the course Websites page to answer various of the questions below. Tip: keep various webpages open simultaneously to more quickly move among them.

Introduction: This exercise will aquaint you with various web resources, particularly those produced by (and sometimes for) systematists. Completing this exercise is much like a scavenger hunt for information - note that some questions ask you to speculate / think of possible explanations. Although there are many informative resources on the web, these links are intended for qualify as a sort of 'primary' source of information in the sense that they include authoritiative information, rather than summaries of such (as seen in secondary sources). Please do not rush through this exercise, take a few moments to appreciate and familiarize yourself with each resource.

 

1. Choose two on-line searchable, taxonomic databases of your choice, preferably that contain taxa in a group with which you are knowledgeable. (The databases can be of different scope/content)

A. List the names and URLs of each database:

B. Search each for the same taxon, of any level, (make sure both have this taxon) and then compare the databases below.  Contrast briefly (1) the ease of use (2) the results provided (3) was one noticeably faster than the other? (4) which did you prefer? Also, indicate what taxon name you used.

 

2. Visit the on-line version of the International Code of Zoological Nomenclature and read the article describing what constitutes a published work (Criteria of publication):

 According "the criteria to be met" can, in your judgement, a webpage count as a published work under the ICZN? Why or why not?

3. Visit the Tree of Life and beginning at the ROOT, click through the tree to locate the most terminal (closest to the species group) pages for a taxon of your research / interest.

 A. The taxon you sought:____________________

 B. Did it have an information page? Y  /  N

 C. If not, how close did you get, i.e. what was the closest page with information?

 

 4. Visit the Society of Systematic Biologists Homepage (http://www.systbio.org/ )

A. How much is a student membership this year?

B. What awards are available for students? Provide their names, award amounts, and for what the award is for (i.e. how to qualify).

5. Visit the Tiger Beetles of Connecticut website (http://collections2.eeb.uconn.edu/collections/insects/CTBnew/ctb.htm)  and identify the following CT tiger beetle: dorsal surface metallic green and lacking rows of small green dots but with small white marks, abdomen brown.  It was found in a forest on a sandy trail.

A. Species name (with author):

B. Is it of conservation concern?

6. Visit the Scarabaeinae Research Network website (http://216.73.242.84/scarabnet/) and identify the following scarab: single horn and color finish is metallic.

Species name (with author):

7. Visit the Natural History Museum guide to twig lichens (http://internt.nhm.ac.uk/jdsml/nature-online/lichen-id-guide/) and identify the following lichen: branched, with fruits present and grooved branches.

A. Species name (with author):

B. Does this lichen species prefer unpolluted areas?

8. Visit the The Systematics Association website: (http://www.systass.org/index.html)

 Go to the Awards link. What are the maximum awards that were given to students for 2003-2004 and how many students got this amount?

9. You have just completed sequencing a new zoological tissue sample and obtained back the following portion of the Cytochrome Oxidase I sequence:

aaaattcaatatatgcataataactaataagtacacagtagagttactgttatctgtgtc

which, surprisingly, does not align (match) with any of your other COI sequences. To help solve this problem you can do a BLAST search on the NCBI website. Click the BLAST link and then under the nucleotide options click on the nucleotide-nucleotide link. Copy the above sequence and paste it into the search field. Then click the Blast! button to search for any matches to this sequence. When the search is complete (you need to click the 'format' button to retrieve your results) you will get a list of possible matches with the best matches near the top.

A. What is the best match for this sequence? Provide the species name & the higher classification for this species.

B. What do you think might have happened? i.e. where did this odd sequence come from?

10. Visit the Scarab Beetle Research site (http://www-museum.unl.edu/research/entomology/index.htm) , now funded in part by an NSF PEET grant.

A. What does the acronym PEET stand for? & Why was this NSF program initiated?

B. Link to the "Guide to New World Scarab Genera" and read the page. Do they use the word 'Classification' as I defined it in lecture 2? Explain.

C. Using this guide find the words to fill in the blanks: "The Hybosoridae is hypothesized to be intermediate between the ____________ and ______________.

11. Visit the Orthoptera Species File online & use the old version (http://www.tettigonia.com/) of the Tettigonoidea database.

A. Search on my last name: Sikes, how many specimens are known? Do you think this is a large enough sample to consider this a distinct species? why or why not?

B. Now click on the link under the images to display all images as thumbnails. You will see 3 images for this species, chose the last one, titillator, and click the link 'compare'. This will produce a list of images of this structure for all the species in the genus present in the database. With what other species are the titllators of E. sikesi most similar? Was it easy to determine? Do you think having more specimens of E. sikesi would reduce our confidence in its status as a distinct species? why or why not?

12. Visit another NSF-PEET funded website (http://collections2.eeb.uconn.edu/PEET/uconnpeet.htm) - this one on cestodes of sharks, skates & rays.

A. search on the specific epithet 'aetobatidis' - how many species have this epithet? Why do you think this epithet was used for these two species?

B. Click on the 'products' link and scroll down to see the productivity of this research group. How many presentations are listed?

13. Visit my own Nicrophorinae Research website:

http://collections2.eeb.uconn.edu/nicroweb/nicrophorus.htm

A. Search the taxonomic catalog for the species Nicrophorus americanus. Look at the synonymy list below the species name. What is the oldest name for this species?

B. Although we haven't covered the rules of nomenclature yet, you may recall from other courses that the oldest name has priority - you will learn later the correct explanation for this, but why do you think, in this case, the oldest name for this species is not the valid name?

C. Click on the link to view the labels of the holotype. There is one label that has a junior synonym of the name N. americanus - what is the name of this junior synonym?

14. Visit Harvard's Museum of Comparative Zoology primary type database:

http://mcz-28168.oeb.harvard.edu/mcztypedb.htm

A. Search the taxonomic catalog for the name Necrophorus. List the different kinds of types specimens that are present:

B. How many of these type specimens' names match their current names? (consider only the specific epithet)

C. You want to verify an identification & think you might have either N. defodiens or N. orbicollis - your specimen has orange antennal clubs. Which of these two species does your specimen agree best with? (use the links to view the images of these specimens).

D. Find the type for Cicindella cyanella & look at the image for the head - dorsal view. The sclerite above the mandibles is called the labrum - how many setae (hairs) are on the labrum of this specimen? Are any broken off? (click on the image to magnify it).

E. Go to the 'About' page and read the section "What Are Primary Types and Why Are They Important to Science?" Then explain why, after reading this, it might be faster for a taxonomist to describe the insect fauna of an unstudied island with 100% new species (that were known beforehand to all be undescribed), than it would be to describe the insect fauna of an island where only half of the species are new (and it was unknown beforehand which were new and which weren't)?

15. Visit the Canadian Arachnologist website, (http://canadianarachnology.webhop.net).

Go to the Nearctic Spider Database. Using the maps link, how many collection sites have been recorded for Pardosa moesta (Family Lycosidae) in Alberta? How many of these collections were made by David Shorthouse? This site is a new creation and shows how Google Technology can be incorporated into taxonomic web "publications."